Review



cas9 rnp mix  (Integrated DNA Technologies)


Bioz Verified Symbol Integrated DNA Technologies is a verified supplier
Bioz Manufacturer Symbol Integrated DNA Technologies manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    Integrated DNA Technologies cas9 rnp mix
    DNA sequence changes mediated by genome editing. (A) DNA sequences of mutant Cbr sdc-2 alleles that were created by genome editing using zinc-finger nucleases, as described in Wood et al . 2011 . Mutations include short insertions (green) and deletions (red colons) that generate in-frame deletions and frame-shift mutations. Inserted sequences (green) frequently share homology (underlined in green) with sequences flanking the break site, as is typical of NHEJ-mediated repair. The deletions in both sdc-2(y467) and sdc-2(y469) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins and causing complete loss of gene function. For y467 , the wild-type sequence ends at codon 926-Asp. The deletion and insertion cause 18 incorrect amino acids to be translated, and a stop codon occurs in place of codon 945. For y469 , the wild-type sequence ends at codon 921-Thr. The deletion causes 26 incorrect amino acids to be translated, and a stop codon occurs in place of codon 948. (B) DNA sequence of mutant Cbr dpy-27(y705) allele created by genome editing using <t>CRISPR/Cas9.</t> The Cas9 target sequence was 5’ CGCTCTGGAGTACGGTAAAA 3’. The PAM is the CGC (red) immediately 3’ of the target sequence. The double strand break (DSB) site is indicated by a blue line. The mutation is a 52 bp deletion (red colons) in exon 4 that creates a premature translation stop codon and prevents formation of the full-length DPY-27 protein. The deletion starts at codon 689, and the in-frame stop codon is 2 codons past the 3’ end of the deletion. (C, D) DNA sequences of mutant Cbr sdc-2 alleles that were obtained as suppressors of the XO-specific lethality caused by a xol-1 mutation. Alleles sdc-2(y453) , sdc-2(y454) , sdc-2(y455) , and sdc-2(y460) , were created by genome editing using zinc-finger nucleases, as described in Wood et al . 2011 . The mutations in both sdc-2(y453) and sdc-2(y454) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins and causing complete loss of gene function. For sdc-2(y453) , the wild-type sequence ends at codon 563-Val. The deletion and insertion cause 6 incorrect amino acids to be translated, and a stop codon occurs in place of codon 570 (554). For sdc-2(y454) , the wild-type sequence ends at codon 563-Val. The deletion and insertion cause 11 incorrect amino acids to be translated, and a stop codon occurs in place of codon 575. The mutations in both sdc-2(y455) and sdc-2(y460) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins. For sdc-2(y455) , the wild-type sequence ends at codon 927-His. The deletion causes 27 incorrect amino acids to be translated, and a stop codon occurs in place of codon 955. For sdc-2(y460) , the wild-type sequence ends at codon 925-Ile. The deletion and insertion cause 34 incorrect amino acids to be translated, and a stop codon occurs in place of codon 960.
    Cas9 Rnp Mix, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 99/100, based on 4157 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cas9 rnp mix/product/Integrated DNA Technologies
    Average 99 stars, based on 4157 article reviews
    cas9 rnp mix - by Bioz Stars, 2026-06
    99/100 stars

    Images

    1) Product Images from "X-Chromosome Target Specificity Diverged Between Dosage Compensation Mechanisms of Two Closely Related Caenorhabditis Species"

    Article Title: X-Chromosome Target Specificity Diverged Between Dosage Compensation Mechanisms of Two Closely Related Caenorhabditis Species

    Journal: bioRxiv

    doi: 10.1101/2022.12.05.519163

    DNA sequence changes mediated by genome editing. (A) DNA sequences of mutant Cbr sdc-2 alleles that were created by genome editing using zinc-finger nucleases, as described in Wood et al . 2011 . Mutations include short insertions (green) and deletions (red colons) that generate in-frame deletions and frame-shift mutations. Inserted sequences (green) frequently share homology (underlined in green) with sequences flanking the break site, as is typical of NHEJ-mediated repair. The deletions in both sdc-2(y467) and sdc-2(y469) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins and causing complete loss of gene function. For y467 , the wild-type sequence ends at codon 926-Asp. The deletion and insertion cause 18 incorrect amino acids to be translated, and a stop codon occurs in place of codon 945. For y469 , the wild-type sequence ends at codon 921-Thr. The deletion causes 26 incorrect amino acids to be translated, and a stop codon occurs in place of codon 948. (B) DNA sequence of mutant Cbr dpy-27(y705) allele created by genome editing using CRISPR/Cas9. The Cas9 target sequence was 5’ CGCTCTGGAGTACGGTAAAA 3’. The PAM is the CGC (red) immediately 3’ of the target sequence. The double strand break (DSB) site is indicated by a blue line. The mutation is a 52 bp deletion (red colons) in exon 4 that creates a premature translation stop codon and prevents formation of the full-length DPY-27 protein. The deletion starts at codon 689, and the in-frame stop codon is 2 codons past the 3’ end of the deletion. (C, D) DNA sequences of mutant Cbr sdc-2 alleles that were obtained as suppressors of the XO-specific lethality caused by a xol-1 mutation. Alleles sdc-2(y453) , sdc-2(y454) , sdc-2(y455) , and sdc-2(y460) , were created by genome editing using zinc-finger nucleases, as described in Wood et al . 2011 . The mutations in both sdc-2(y453) and sdc-2(y454) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins and causing complete loss of gene function. For sdc-2(y453) , the wild-type sequence ends at codon 563-Val. The deletion and insertion cause 6 incorrect amino acids to be translated, and a stop codon occurs in place of codon 570 (554). For sdc-2(y454) , the wild-type sequence ends at codon 563-Val. The deletion and insertion cause 11 incorrect amino acids to be translated, and a stop codon occurs in place of codon 575. The mutations in both sdc-2(y455) and sdc-2(y460) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins. For sdc-2(y455) , the wild-type sequence ends at codon 927-His. The deletion causes 27 incorrect amino acids to be translated, and a stop codon occurs in place of codon 955. For sdc-2(y460) , the wild-type sequence ends at codon 925-Ile. The deletion and insertion cause 34 incorrect amino acids to be translated, and a stop codon occurs in place of codon 960.
    Figure Legend Snippet: DNA sequence changes mediated by genome editing. (A) DNA sequences of mutant Cbr sdc-2 alleles that were created by genome editing using zinc-finger nucleases, as described in Wood et al . 2011 . Mutations include short insertions (green) and deletions (red colons) that generate in-frame deletions and frame-shift mutations. Inserted sequences (green) frequently share homology (underlined in green) with sequences flanking the break site, as is typical of NHEJ-mediated repair. The deletions in both sdc-2(y467) and sdc-2(y469) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins and causing complete loss of gene function. For y467 , the wild-type sequence ends at codon 926-Asp. The deletion and insertion cause 18 incorrect amino acids to be translated, and a stop codon occurs in place of codon 945. For y469 , the wild-type sequence ends at codon 921-Thr. The deletion causes 26 incorrect amino acids to be translated, and a stop codon occurs in place of codon 948. (B) DNA sequence of mutant Cbr dpy-27(y705) allele created by genome editing using CRISPR/Cas9. The Cas9 target sequence was 5’ CGCTCTGGAGTACGGTAAAA 3’. The PAM is the CGC (red) immediately 3’ of the target sequence. The double strand break (DSB) site is indicated by a blue line. The mutation is a 52 bp deletion (red colons) in exon 4 that creates a premature translation stop codon and prevents formation of the full-length DPY-27 protein. The deletion starts at codon 689, and the in-frame stop codon is 2 codons past the 3’ end of the deletion. (C, D) DNA sequences of mutant Cbr sdc-2 alleles that were obtained as suppressors of the XO-specific lethality caused by a xol-1 mutation. Alleles sdc-2(y453) , sdc-2(y454) , sdc-2(y455) , and sdc-2(y460) , were created by genome editing using zinc-finger nucleases, as described in Wood et al . 2011 . The mutations in both sdc-2(y453) and sdc-2(y454) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins and causing complete loss of gene function. For sdc-2(y453) , the wild-type sequence ends at codon 563-Val. The deletion and insertion cause 6 incorrect amino acids to be translated, and a stop codon occurs in place of codon 570 (554). For sdc-2(y454) , the wild-type sequence ends at codon 563-Val. The deletion and insertion cause 11 incorrect amino acids to be translated, and a stop codon occurs in place of codon 575. The mutations in both sdc-2(y455) and sdc-2(y460) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins. For sdc-2(y455) , the wild-type sequence ends at codon 927-His. The deletion causes 27 incorrect amino acids to be translated, and a stop codon occurs in place of codon 955. For sdc-2(y460) , the wild-type sequence ends at codon 925-Ile. The deletion and insertion cause 34 incorrect amino acids to be translated, and a stop codon occurs in place of codon 960.

    Techniques Used: Sequencing, Mutagenesis, Zinc-Fingers, CRISPR

    List of target-specific sequences for guide RNAs used in CRISPR / Cas9 genome editing experiments
    Figure Legend Snippet: List of target-specific sequences for guide RNAs used in CRISPR / Cas9 genome editing experiments

    Techniques Used: CRISPR

    DNA sequences of repair templates used in CRISPR / Cas9 genome editing experiments
    Figure Legend Snippet: DNA sequences of repair templates used in CRISPR / Cas9 genome editing experiments

    Techniques Used: CRISPR



    Similar Products

    cas9 rnp mix  (Integrated DNA Technologies)
    99
    Integrated DNA Technologies cas9 rnp mix
    DNA sequence changes mediated by genome editing. (A) DNA sequences of mutant Cbr sdc-2 alleles that were created by genome editing using zinc-finger nucleases, as described in Wood et al . 2011 . Mutations include short insertions (green) and deletions (red colons) that generate in-frame deletions and frame-shift mutations. Inserted sequences (green) frequently share homology (underlined in green) with sequences flanking the break site, as is typical of NHEJ-mediated repair. The deletions in both sdc-2(y467) and sdc-2(y469) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins and causing complete loss of gene function. For y467 , the wild-type sequence ends at codon 926-Asp. The deletion and insertion cause 18 incorrect amino acids to be translated, and a stop codon occurs in place of codon 945. For y469 , the wild-type sequence ends at codon 921-Thr. The deletion causes 26 incorrect amino acids to be translated, and a stop codon occurs in place of codon 948. (B) DNA sequence of mutant Cbr dpy-27(y705) allele created by genome editing using <t>CRISPR/Cas9.</t> The Cas9 target sequence was 5’ CGCTCTGGAGTACGGTAAAA 3’. The PAM is the CGC (red) immediately 3’ of the target sequence. The double strand break (DSB) site is indicated by a blue line. The mutation is a 52 bp deletion (red colons) in exon 4 that creates a premature translation stop codon and prevents formation of the full-length DPY-27 protein. The deletion starts at codon 689, and the in-frame stop codon is 2 codons past the 3’ end of the deletion. (C, D) DNA sequences of mutant Cbr sdc-2 alleles that were obtained as suppressors of the XO-specific lethality caused by a xol-1 mutation. Alleles sdc-2(y453) , sdc-2(y454) , sdc-2(y455) , and sdc-2(y460) , were created by genome editing using zinc-finger nucleases, as described in Wood et al . 2011 . The mutations in both sdc-2(y453) and sdc-2(y454) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins and causing complete loss of gene function. For sdc-2(y453) , the wild-type sequence ends at codon 563-Val. The deletion and insertion cause 6 incorrect amino acids to be translated, and a stop codon occurs in place of codon 570 (554). For sdc-2(y454) , the wild-type sequence ends at codon 563-Val. The deletion and insertion cause 11 incorrect amino acids to be translated, and a stop codon occurs in place of codon 575. The mutations in both sdc-2(y455) and sdc-2(y460) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins. For sdc-2(y455) , the wild-type sequence ends at codon 927-His. The deletion causes 27 incorrect amino acids to be translated, and a stop codon occurs in place of codon 955. For sdc-2(y460) , the wild-type sequence ends at codon 925-Ile. The deletion and insertion cause 34 incorrect amino acids to be translated, and a stop codon occurs in place of codon 960.
    Cas9 Rnp Mix, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cas9 rnp mix/product/Integrated DNA Technologies
    Average 99 stars, based on 1 article reviews
    cas9 rnp mix - by Bioz Stars, 2026-06
    99/100 stars
    		  Buy from Supplier
    rnp injection mix  (New England Biolabs)
    97
    New England Biolabs rnp injection mix
    DNA sequence changes mediated by genome editing. (A) DNA sequences of mutant Cbr sdc-2 alleles that were created by genome editing using zinc-finger nucleases, as described in Wood et al . 2011 . Mutations include short insertions (green) and deletions (red colons) that generate in-frame deletions and frame-shift mutations. Inserted sequences (green) frequently share homology (underlined in green) with sequences flanking the break site, as is typical of NHEJ-mediated repair. The deletions in both sdc-2(y467) and sdc-2(y469) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins and causing complete loss of gene function. For y467 , the wild-type sequence ends at codon 926-Asp. The deletion and insertion cause 18 incorrect amino acids to be translated, and a stop codon occurs in place of codon 945. For y469 , the wild-type sequence ends at codon 921-Thr. The deletion causes 26 incorrect amino acids to be translated, and a stop codon occurs in place of codon 948. (B) DNA sequence of mutant Cbr dpy-27(y705) allele created by genome editing using <t>CRISPR/Cas9.</t> The Cas9 target sequence was 5’ CGCTCTGGAGTACGGTAAAA 3’. The PAM is the CGC (red) immediately 3’ of the target sequence. The double strand break (DSB) site is indicated by a blue line. The mutation is a 52 bp deletion (red colons) in exon 4 that creates a premature translation stop codon and prevents formation of the full-length DPY-27 protein. The deletion starts at codon 689, and the in-frame stop codon is 2 codons past the 3’ end of the deletion. (C, D) DNA sequences of mutant Cbr sdc-2 alleles that were obtained as suppressors of the XO-specific lethality caused by a xol-1 mutation. Alleles sdc-2(y453) , sdc-2(y454) , sdc-2(y455) , and sdc-2(y460) , were created by genome editing using zinc-finger nucleases, as described in Wood et al . 2011 . The mutations in both sdc-2(y453) and sdc-2(y454) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins and causing complete loss of gene function. For sdc-2(y453) , the wild-type sequence ends at codon 563-Val. The deletion and insertion cause 6 incorrect amino acids to be translated, and a stop codon occurs in place of codon 570 (554). For sdc-2(y454) , the wild-type sequence ends at codon 563-Val. The deletion and insertion cause 11 incorrect amino acids to be translated, and a stop codon occurs in place of codon 575. The mutations in both sdc-2(y455) and sdc-2(y460) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins. For sdc-2(y455) , the wild-type sequence ends at codon 927-His. The deletion causes 27 incorrect amino acids to be translated, and a stop codon occurs in place of codon 955. For sdc-2(y460) , the wild-type sequence ends at codon 925-Ile. The deletion and insertion cause 34 incorrect amino acids to be translated, and a stop codon occurs in place of codon 960.
    Rnp Injection Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnp injection mix/product/New England Biolabs
    Average 97 stars, based on 1 article reviews
    rnp injection mix - by Bioz Stars, 2026-06
    97/100 stars
    		  Buy from Supplier
    cas9 rnp mix  (Lonza)
    90
    Lonza cas9 rnp mix
    DNA sequence changes mediated by genome editing. (A) DNA sequences of mutant Cbr sdc-2 alleles that were created by genome editing using zinc-finger nucleases, as described in Wood et al . 2011 . Mutations include short insertions (green) and deletions (red colons) that generate in-frame deletions and frame-shift mutations. Inserted sequences (green) frequently share homology (underlined in green) with sequences flanking the break site, as is typical of NHEJ-mediated repair. The deletions in both sdc-2(y467) and sdc-2(y469) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins and causing complete loss of gene function. For y467 , the wild-type sequence ends at codon 926-Asp. The deletion and insertion cause 18 incorrect amino acids to be translated, and a stop codon occurs in place of codon 945. For y469 , the wild-type sequence ends at codon 921-Thr. The deletion causes 26 incorrect amino acids to be translated, and a stop codon occurs in place of codon 948. (B) DNA sequence of mutant Cbr dpy-27(y705) allele created by genome editing using <t>CRISPR/Cas9.</t> The Cas9 target sequence was 5’ CGCTCTGGAGTACGGTAAAA 3’. The PAM is the CGC (red) immediately 3’ of the target sequence. The double strand break (DSB) site is indicated by a blue line. The mutation is a 52 bp deletion (red colons) in exon 4 that creates a premature translation stop codon and prevents formation of the full-length DPY-27 protein. The deletion starts at codon 689, and the in-frame stop codon is 2 codons past the 3’ end of the deletion. (C, D) DNA sequences of mutant Cbr sdc-2 alleles that were obtained as suppressors of the XO-specific lethality caused by a xol-1 mutation. Alleles sdc-2(y453) , sdc-2(y454) , sdc-2(y455) , and sdc-2(y460) , were created by genome editing using zinc-finger nucleases, as described in Wood et al . 2011 . The mutations in both sdc-2(y453) and sdc-2(y454) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins and causing complete loss of gene function. For sdc-2(y453) , the wild-type sequence ends at codon 563-Val. The deletion and insertion cause 6 incorrect amino acids to be translated, and a stop codon occurs in place of codon 570 (554). For sdc-2(y454) , the wild-type sequence ends at codon 563-Val. The deletion and insertion cause 11 incorrect amino acids to be translated, and a stop codon occurs in place of codon 575. The mutations in both sdc-2(y455) and sdc-2(y460) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins. For sdc-2(y455) , the wild-type sequence ends at codon 927-His. The deletion causes 27 incorrect amino acids to be translated, and a stop codon occurs in place of codon 955. For sdc-2(y460) , the wild-type sequence ends at codon 925-Ile. The deletion and insertion cause 34 incorrect amino acids to be translated, and a stop codon occurs in place of codon 960.
    Cas9 Rnp Mix, supplied by Lonza, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cas9 rnp mix/product/Lonza
    Average 90 stars, based on 1 article reviews
    cas9 rnp mix - by Bioz Stars, 2026-06
    90/100 stars
    		  Buy from Supplier
    cas9 rnp mixed-irak3 sgrna  (Synthego Inc)
    90
    Synthego Inc cas9 rnp mixed-irak3 sgrna
    DNA sequence changes mediated by genome editing. (A) DNA sequences of mutant Cbr sdc-2 alleles that were created by genome editing using zinc-finger nucleases, as described in Wood et al . 2011 . Mutations include short insertions (green) and deletions (red colons) that generate in-frame deletions and frame-shift mutations. Inserted sequences (green) frequently share homology (underlined in green) with sequences flanking the break site, as is typical of NHEJ-mediated repair. The deletions in both sdc-2(y467) and sdc-2(y469) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins and causing complete loss of gene function. For y467 , the wild-type sequence ends at codon 926-Asp. The deletion and insertion cause 18 incorrect amino acids to be translated, and a stop codon occurs in place of codon 945. For y469 , the wild-type sequence ends at codon 921-Thr. The deletion causes 26 incorrect amino acids to be translated, and a stop codon occurs in place of codon 948. (B) DNA sequence of mutant Cbr dpy-27(y705) allele created by genome editing using <t>CRISPR/Cas9.</t> The Cas9 target sequence was 5’ CGCTCTGGAGTACGGTAAAA 3’. The PAM is the CGC (red) immediately 3’ of the target sequence. The double strand break (DSB) site is indicated by a blue line. The mutation is a 52 bp deletion (red colons) in exon 4 that creates a premature translation stop codon and prevents formation of the full-length DPY-27 protein. The deletion starts at codon 689, and the in-frame stop codon is 2 codons past the 3’ end of the deletion. (C, D) DNA sequences of mutant Cbr sdc-2 alleles that were obtained as suppressors of the XO-specific lethality caused by a xol-1 mutation. Alleles sdc-2(y453) , sdc-2(y454) , sdc-2(y455) , and sdc-2(y460) , were created by genome editing using zinc-finger nucleases, as described in Wood et al . 2011 . The mutations in both sdc-2(y453) and sdc-2(y454) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins and causing complete loss of gene function. For sdc-2(y453) , the wild-type sequence ends at codon 563-Val. The deletion and insertion cause 6 incorrect amino acids to be translated, and a stop codon occurs in place of codon 570 (554). For sdc-2(y454) , the wild-type sequence ends at codon 563-Val. The deletion and insertion cause 11 incorrect amino acids to be translated, and a stop codon occurs in place of codon 575. The mutations in both sdc-2(y455) and sdc-2(y460) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins. For sdc-2(y455) , the wild-type sequence ends at codon 927-His. The deletion causes 27 incorrect amino acids to be translated, and a stop codon occurs in place of codon 955. For sdc-2(y460) , the wild-type sequence ends at codon 925-Ile. The deletion and insertion cause 34 incorrect amino acids to be translated, and a stop codon occurs in place of codon 960.
    Cas9 Rnp Mixed Irak3 Sgrna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cas9 rnp mixed-irak3 sgrna/product/Synthego Inc
    Average 90 stars, based on 1 article reviews
    cas9 rnp mixed-irak3 sgrna - by Bioz Stars, 2026-06
    90/100 stars
    		  Buy from Supplier
    cas9 rnp/hr template mix  (Lonza)
    90
    Lonza cas9 rnp/hr template mix
    DNA sequence changes mediated by genome editing. (A) DNA sequences of mutant Cbr sdc-2 alleles that were created by genome editing using zinc-finger nucleases, as described in Wood et al . 2011 . Mutations include short insertions (green) and deletions (red colons) that generate in-frame deletions and frame-shift mutations. Inserted sequences (green) frequently share homology (underlined in green) with sequences flanking the break site, as is typical of NHEJ-mediated repair. The deletions in both sdc-2(y467) and sdc-2(y469) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins and causing complete loss of gene function. For y467 , the wild-type sequence ends at codon 926-Asp. The deletion and insertion cause 18 incorrect amino acids to be translated, and a stop codon occurs in place of codon 945. For y469 , the wild-type sequence ends at codon 921-Thr. The deletion causes 26 incorrect amino acids to be translated, and a stop codon occurs in place of codon 948. (B) DNA sequence of mutant Cbr dpy-27(y705) allele created by genome editing using <t>CRISPR/Cas9.</t> The Cas9 target sequence was 5’ CGCTCTGGAGTACGGTAAAA 3’. The PAM is the CGC (red) immediately 3’ of the target sequence. The double strand break (DSB) site is indicated by a blue line. The mutation is a 52 bp deletion (red colons) in exon 4 that creates a premature translation stop codon and prevents formation of the full-length DPY-27 protein. The deletion starts at codon 689, and the in-frame stop codon is 2 codons past the 3’ end of the deletion. (C, D) DNA sequences of mutant Cbr sdc-2 alleles that were obtained as suppressors of the XO-specific lethality caused by a xol-1 mutation. Alleles sdc-2(y453) , sdc-2(y454) , sdc-2(y455) , and sdc-2(y460) , were created by genome editing using zinc-finger nucleases, as described in Wood et al . 2011 . The mutations in both sdc-2(y453) and sdc-2(y454) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins and causing complete loss of gene function. For sdc-2(y453) , the wild-type sequence ends at codon 563-Val. The deletion and insertion cause 6 incorrect amino acids to be translated, and a stop codon occurs in place of codon 570 (554). For sdc-2(y454) , the wild-type sequence ends at codon 563-Val. The deletion and insertion cause 11 incorrect amino acids to be translated, and a stop codon occurs in place of codon 575. The mutations in both sdc-2(y455) and sdc-2(y460) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins. For sdc-2(y455) , the wild-type sequence ends at codon 927-His. The deletion causes 27 incorrect amino acids to be translated, and a stop codon occurs in place of codon 955. For sdc-2(y460) , the wild-type sequence ends at codon 925-Ile. The deletion and insertion cause 34 incorrect amino acids to be translated, and a stop codon occurs in place of codon 960.
    Cas9 Rnp/Hr Template Mix, supplied by Lonza, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cas9 rnp/hr template mix/product/Lonza
    Average 90 stars, based on 1 article reviews
    cas9 rnp/hr template mix - by Bioz Stars, 2026-06
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    DNA sequence changes mediated by genome editing. (A) DNA sequences of mutant Cbr sdc-2 alleles that were created by genome editing using zinc-finger nucleases, as described in Wood et al . 2011 . Mutations include short insertions (green) and deletions (red colons) that generate in-frame deletions and frame-shift mutations. Inserted sequences (green) frequently share homology (underlined in green) with sequences flanking the break site, as is typical of NHEJ-mediated repair. The deletions in both sdc-2(y467) and sdc-2(y469) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins and causing complete loss of gene function. For y467 , the wild-type sequence ends at codon 926-Asp. The deletion and insertion cause 18 incorrect amino acids to be translated, and a stop codon occurs in place of codon 945. For y469 , the wild-type sequence ends at codon 921-Thr. The deletion causes 26 incorrect amino acids to be translated, and a stop codon occurs in place of codon 948. (B) DNA sequence of mutant Cbr dpy-27(y705) allele created by genome editing using CRISPR/Cas9. The Cas9 target sequence was 5’ CGCTCTGGAGTACGGTAAAA 3’. The PAM is the CGC (red) immediately 3’ of the target sequence. The double strand break (DSB) site is indicated by a blue line. The mutation is a 52 bp deletion (red colons) in exon 4 that creates a premature translation stop codon and prevents formation of the full-length DPY-27 protein. The deletion starts at codon 689, and the in-frame stop codon is 2 codons past the 3’ end of the deletion. (C, D) DNA sequences of mutant Cbr sdc-2 alleles that were obtained as suppressors of the XO-specific lethality caused by a xol-1 mutation. Alleles sdc-2(y453) , sdc-2(y454) , sdc-2(y455) , and sdc-2(y460) , were created by genome editing using zinc-finger nucleases, as described in Wood et al . 2011 . The mutations in both sdc-2(y453) and sdc-2(y454) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins and causing complete loss of gene function. For sdc-2(y453) , the wild-type sequence ends at codon 563-Val. The deletion and insertion cause 6 incorrect amino acids to be translated, and a stop codon occurs in place of codon 570 (554). For sdc-2(y454) , the wild-type sequence ends at codon 563-Val. The deletion and insertion cause 11 incorrect amino acids to be translated, and a stop codon occurs in place of codon 575. The mutations in both sdc-2(y455) and sdc-2(y460) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins. For sdc-2(y455) , the wild-type sequence ends at codon 927-His. The deletion causes 27 incorrect amino acids to be translated, and a stop codon occurs in place of codon 955. For sdc-2(y460) , the wild-type sequence ends at codon 925-Ile. The deletion and insertion cause 34 incorrect amino acids to be translated, and a stop codon occurs in place of codon 960.

    Journal: bioRxiv

    Article Title: X-Chromosome Target Specificity Diverged Between Dosage Compensation Mechanisms of Two Closely Related Caenorhabditis Species

    doi: 10.1101/2022.12.05.519163

    Figure Lengend Snippet: DNA sequence changes mediated by genome editing. (A) DNA sequences of mutant Cbr sdc-2 alleles that were created by genome editing using zinc-finger nucleases, as described in Wood et al . 2011 . Mutations include short insertions (green) and deletions (red colons) that generate in-frame deletions and frame-shift mutations. Inserted sequences (green) frequently share homology (underlined in green) with sequences flanking the break site, as is typical of NHEJ-mediated repair. The deletions in both sdc-2(y467) and sdc-2(y469) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins and causing complete loss of gene function. For y467 , the wild-type sequence ends at codon 926-Asp. The deletion and insertion cause 18 incorrect amino acids to be translated, and a stop codon occurs in place of codon 945. For y469 , the wild-type sequence ends at codon 921-Thr. The deletion causes 26 incorrect amino acids to be translated, and a stop codon occurs in place of codon 948. (B) DNA sequence of mutant Cbr dpy-27(y705) allele created by genome editing using CRISPR/Cas9. The Cas9 target sequence was 5’ CGCTCTGGAGTACGGTAAAA 3’. The PAM is the CGC (red) immediately 3’ of the target sequence. The double strand break (DSB) site is indicated by a blue line. The mutation is a 52 bp deletion (red colons) in exon 4 that creates a premature translation stop codon and prevents formation of the full-length DPY-27 protein. The deletion starts at codon 689, and the in-frame stop codon is 2 codons past the 3’ end of the deletion. (C, D) DNA sequences of mutant Cbr sdc-2 alleles that were obtained as suppressors of the XO-specific lethality caused by a xol-1 mutation. Alleles sdc-2(y453) , sdc-2(y454) , sdc-2(y455) , and sdc-2(y460) , were created by genome editing using zinc-finger nucleases, as described in Wood et al . 2011 . The mutations in both sdc-2(y453) and sdc-2(y454) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins and causing complete loss of gene function. For sdc-2(y453) , the wild-type sequence ends at codon 563-Val. The deletion and insertion cause 6 incorrect amino acids to be translated, and a stop codon occurs in place of codon 570 (554). For sdc-2(y454) , the wild-type sequence ends at codon 563-Val. The deletion and insertion cause 11 incorrect amino acids to be translated, and a stop codon occurs in place of codon 575. The mutations in both sdc-2(y455) and sdc-2(y460) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins. For sdc-2(y455) , the wild-type sequence ends at codon 927-His. The deletion causes 27 incorrect amino acids to be translated, and a stop codon occurs in place of codon 955. For sdc-2(y460) , the wild-type sequence ends at codon 925-Ile. The deletion and insertion cause 34 incorrect amino acids to be translated, and a stop codon occurs in place of codon 960.

    Article Snippet: The Cas9 RNP mix was incubated at 37 °C for 15 min, and 1 μl of the resulting Cas9 RNP mix was combined with 0.5 μl 10 μM dpy-10 repair oligo (IDT), 0.5 μl 10 μM rex repair oligo (IDT), and 8 μl nuclease-free water.

    Techniques: Sequencing, Mutagenesis, Zinc-Fingers, CRISPR

    List of target-specific sequences for guide RNAs used in CRISPR / Cas9 genome editing experiments

    Journal: bioRxiv

    Article Title: X-Chromosome Target Specificity Diverged Between Dosage Compensation Mechanisms of Two Closely Related Caenorhabditis Species

    doi: 10.1101/2022.12.05.519163

    Figure Lengend Snippet: List of target-specific sequences for guide RNAs used in CRISPR / Cas9 genome editing experiments

    Article Snippet: The Cas9 RNP mix was incubated at 37 °C for 15 min, and 1 μl of the resulting Cas9 RNP mix was combined with 0.5 μl 10 μM dpy-10 repair oligo (IDT), 0.5 μl 10 μM rex repair oligo (IDT), and 8 μl nuclease-free water.

    Techniques: CRISPR

    DNA sequences of repair templates used in CRISPR / Cas9 genome editing experiments

    Journal: bioRxiv

    Article Title: X-Chromosome Target Specificity Diverged Between Dosage Compensation Mechanisms of Two Closely Related Caenorhabditis Species

    doi: 10.1101/2022.12.05.519163

    Figure Lengend Snippet: DNA sequences of repair templates used in CRISPR / Cas9 genome editing experiments

    Article Snippet: The Cas9 RNP mix was incubated at 37 °C for 15 min, and 1 μl of the resulting Cas9 RNP mix was combined with 0.5 μl 10 μM dpy-10 repair oligo (IDT), 0.5 μl 10 μM rex repair oligo (IDT), and 8 μl nuclease-free water.

    Techniques: CRISPR